First Release, Latest online

An affinity-enhanced, broadly neutralizing heavy chain-only antibody protects against SARS-CoV-2 infection in animal models

Okinawa Flat Belly Tonic Okinawa Flat Belly Tonic

RESULTS

Protection in K18-hACE2 mice is conferred by VHH72 that binds a highly conserved region in the RBD of SARS-CoV-2. To obtain additional evidence of the in vivo protective potential of our broadly neutralizing VHH72-Fc prototype, we employed mice expressing human ACE2 driven by the keratin 18 promotor (K18-hACE2 transgenic mice), which are susceptible to SARS-CoV-1 and -2 infection (18, 19). VHH72-Fc is here referred to as WT-VHH/12GS-WT-Fc and was produced in Chinese hamster ovary (CHO) cells (table S1). K18-hACE2 transgenic mice that were intraperitoneally injected with 5 mg/kg of WT-VHH/12GS-WT-Fc and challenged 7 hours later with a dose of 8×103 plaque forming units of a clinical isolate of SARS-CoV-2 displayed no body weight loss, survived viral challenge and had significantly reduced lung virus titers on day 3 after infection compared to control treated animals (P = 0.0015 and P = 0,0379 for respectively, Fig. 1A to C). In addition, intranasal administration of WT-VHH/12GS-WT-Fc at a dose of 20 μg per mouse (approximately 1 mg/kg) protected against SARS-CoV-2-induced disease (P P = 0.0148 for respectively, Fig. 1D and E). Viral titers in the lungs were also significantly reduced in WT-VHH/12GS-WT-Fc-treated mice when compared with the controls (P = 0.0105 Fig. 1F). Thus, prototype molecule WT-VHH/12GS-WT-Fc protects against SARS-CoV-2 virus challenge in a prophylactic setting in both K18-hACE2 mice and hamsters (14).

Fig. 1 WT-VHH/12GS-WT-Fc protects K18-hACE2 transgenic mice against SARS-CoV-2 infection.

(A to C) Mice received 5 mg/kg of WT-VHH/12GS-WT-Fc (n = 17) or control M2e-VHH-Fc by intraperitoneal injection (n = 10). Mice were challenged 7 hours later with 8 × 103 PFU of SARS-CoV-2. (A) Body weight was measured over the course of infection and plotted relative to starting body weight. Symbols represent mean ± SD; p < 0.0001 by a two-way ANOVA. (B) Survival after challenge with SARS-CoV-2 is shown; p = 0.0015 by Mantel-Cox test. (C) Lung viral loads were determined on day 3 after infection from euthanized mice. *p<0.05 by an unpaired t test. Data in (A) and (B) are pooled from two independent experiments. (D to F) Mice received 20 μg of either WT-VHH/12GS-WT-Fc (n = 15) or M2e-VHH-Fc (n = 14) intranasally. Mice were challenged 7 hours later with 8 × 103 PFU of SARS-CoV-2, and body weight loss (D, symbols represent means ± SD, p < 0.0001 by two-way ANOVA) and survival (E, p = 0.0148 by Mantel-Cox test) are shown. (F) Lung viral loads were determined on day 3 after infection from euthanized mice (n = 7 per group). **p<0.05 by an unpaired t test with Welsh correction. Symbols in (C) and (F) represent individual mice and lines indicate mean ± SD. Dotted lines in (C) and (F) indicate lower limit of detection.

VHH72 binds to a region in the core of the RBD that is distal from the much more variable RBM (13). Free energy contribution analysis by FastContact (20) of snapshots from Molecular Dynamics simulations with the VHH72-RBD complex indicates that the epitope recognized by VHH72 has a prominent two-residue hot-spot, consisting of F377 and K378, which contact VHH72 residues V100 and D100 g (Kabat numbering), respectively (fig. S1A). The epitope is exposed only when the trimeric spike protein has at least one RBD in an ‘up’ conformation (fig. S1B). In the three-RBD ‘down’ state, the VHH72 contact region belongs to an occluded zone that makes mutual contacts with the adjacent RBDs (fig. S1C), as well as with the helix-turn-helix positioned between heptad repeat 1 and the central helix of the underlying S2 domain. These subtle inter-RBD and inter-S1/S2 contacts allow oscillation between the RBD ‘down’ and the ACE2-engaging ‘up’ positioning (21, 22). Presumably due to this involvement in spike conformational dynamics, the amino acid residues that contribute to the VHH72 contact region are remarkably conserved in circulating strains of SARS-CoV-2 virus (fig. S2). Moreover, deep mutational scanning analysis has shown that most mutations in the VHH72 contact region severely compromise the fold (23). Together, these findings support the subsequent VHH72-Fc-based drug development trajectory that resulted in the candidate anti-COVID-19 biologic XVR011 (fig. S3).
Design and selection of a VHH72 variant with increased neutralizing activity. To further enhance the potency of the prototype VHH72-Fc molecule, we applied a protein modeling-based design approach to identify a VHH72 variant with increased affinity for SARS-CoV-2 RBD through the iterative threading assembly refinement (I-TASSER) server (24) and Swiss-PdbViewer (25) based on the SARS-CoV-1 RBD/VHH72 structure (Fig. 2A). Only three residues are different between SARS-CoV-2 and -1 at the VHH72-RBD interface: (1) A372 (T359 in SARS-CoV-1), resulting in the loss of a glycan on N370 (N357 in SARS-CoV-1); (2) N439 (R426 in SARS-CoV-1), resulting in the loss of an ionic interaction with VHH72 residue D61; and (3) P384 (A371 in SARS-CoV-1). Close to P384 is Y369, for which I-TASSER predicted an upward conformation in the SARS-CoV-2 RBD-VHH72 model (Fig. 2A). The up-conformation of SARS-CoV-2 Y369 sets it in a hydrophobic small cavity of VHH72, contacting complementarity-determining region 2 (CDR2) residues S52, W52a, S53, S56 and CDR3 residue V100 (Fig. 2A). Molecular dynamics simulations with Gromacs (26) shows that Y369 can be readily accommodated in that cavity. Interestingly, the later reported cryo-electron microscopy (EM) or crystal structures of SARS-CoV-2 RBD typically show Y369 in the upward conformation (2729).

Fig. 2 A computationally predicted VHH72 variant demonstrates enhanced neutralizing activity.

(A) Left: composite structure overlay of VHH72 (gray), ACE2 (orange), and SARS-CoV-2 RBD (cyan). RBD Tyr369, Lys417, Asn439, Leu452, Ser477, Glu484, and Asn501 are shown as sticks. ACE2 Asn322 and RBD Asn343 N-glycans are shown as orange and cyan sticks, respectively. Right: close up view of VHH72 bound to SARS-CoV-1 and -2 RBD (cyan) based on pdb-entry 6WAQ and, for SARS-CoV-2 RBD, a homology model. Residues in CDR2 and -3 of VHH72 and of the RBDs that are in close proximity are shown as sticks. SARS-CoV-1 RBD Tyr356 is oriented downward and its counterpart Tyr369 in the SARS-CoV-2 RBD is oriented upward. (B) BLI sensorgrams of humVHH (top) and humVHH_S56A (bottom) are shown as a two-fold dilution series starting at 100 nM to measure binding to immobilized SARS-CoV-2 RBD fused to a monomeric human IgG Fc. Blue and red lines represent double reference-subtracted data and the fit of the data to a 1:1 binding curve is in black. (C) humVHH and humVHH_S56A binding to SARS-CoV-2 spike as measured by an ELISA is shown. Data points indicate mean ± SEM; N = 3. (D) humVHH and humVHH_S56A binding to HEK293 cell surface expressed SARS-CoV-2 spike was determined by flow cytometry. GFP fluorescence is shown normalized to the mean GFP fluorescence of non-infected and infected PBS-treated cells. GBP, GFP-binding protein (a VHH directed against GFP); MFI, mean fluorescence intensity. (E) Inhibition of SARS-CoV-2 RBD binding to Vero E6 cells was determined by flow cytometry (mean ± SD, N = 3). (F) Neutralization of SARS-CoV-2 spike VSV pseudotypes and (G) SARS-CoV-1 spike VSV pseudotypes by humVHH and humVHH_S56A was measured by fluorimetry. Symbols represent mean ± SD (N = 4).

Guided by molecular modeling, we generated a set of VHH72 variants with point mutations in the residues that line the cavity that accommodates Y369 of SARS-CoV-2 RBD. These variants were rapidly prototyped in parallel as Fc fusions in the yeast Pichia pastoris to ensure that we would only prioritize mutations that enhanced affinity in our intended bivalent Fc-fusion drug context. Introduction of S56A resulted in slower dissociation in this bivalent context and enhanced binding to SARS-CoV-2 spike expressed on the surface of 293T cells (fig. S4). Based on this prototyping in Pichia pastoris, we selected VHH72 with a S56A mutation in the CDR2 for further analysis. All VHH72-Fc fusion constructs mentioned below were produced in and purified from transiently transfected CHO cells.

Next, we humanized the monovalent VHH72, introduced the S56A mutation, and the N-terminal glutamine was replaced by a glutamic acid codon to avoid N-terminal pyroglutamate formation (fig. S5). The S56A substitution increased the affinity of the monomeric humanized VHH72 for immobilized SARS-CoV-2 RBD, by approximately seven-fold (Fig. 2B). Increased affinity of humVHH_S56A for SARS-CoV-2 spike was also observed in enzyme-linked immunosorbent assay (ELISA) and for SARS-CoV-2 spike expressed on the surface of mammalian cells by flow cytometry (Fig. 2C and D). In addition, humVHH_S56A prevented the binding of SARS-CoV-2 RBD to ACE2 on the surface of Vero E6 cells seven times better than humVHH (Fig. 2E). This improved affinity correlated with significantly stronger neutralizing activity of hum_S56A (P = 0.0108, Fig. 2F). Importantly, humVHH_S56A also neutralized vesicular stomatitis virus (VSV) SARS-CoV-1 spike pseudotype virus with 10-fold higher potency and bound with higher affinity to SARS-CoV-1 spike and RBD than humVHH (Fig. 2G and fig. S6).
VHH72_S56A-Fc silenced constructs with potent SARS-CoV-2 neutralizing activity. There is uncertainty about the possible contribution of IgG effector functions to disease severity in COVID-19 patients (30, 31). We opted to use the well-characterized LALA mutations in the Fc portion of our VHH72-Fc construct, with or without the P329G mutation (LALAPG) (3234). We validated that neither the Gly-Ser linker length between the VHH and the Fc hinge (2 or 14 amino acids), nor the humanization of the VHH nor the introduction of LALAPG mutations in the Fc affected the affinity for SARS-CoV-2 spike protein or its RBD, as determined by biolayer interferometry (BLI), ELISA, flow cytometry, or an ACE2 competition assay (Fig. 3A to E and fig. S7A and B). We note that the 1:1 BLI fits of 2:2 interactions between bivalent VHH-Fcs and immobilized RBD yielded ‘apparent affinity constants’. Consistent with the unaltered affinity, neutralization of authentic SARS-CoV-2 virus was unaffected by these changes in the Fc region (table S1). Subsequently, we built the S56A humanized VHH variants of the WT and LALAPG-Fc-fusions. We observed 2 to 3-fold higher affinity of the VHH72-S56A-Fc constructs for immobilized bivalent SARS-CoV-2 RBD and mammalian cells expressing surface spike protein, as well as increased competition with the RBD for ACE2 binding (Fig. 3A to E and fig. S7). This resulted in a seven-fold enhanced potency in an authentic SARS-CoV-2 neutralization assay (for example, humVHH_S56A/LALAPG-Fc: 0.13 μg/ml compared with humVHH/LALAPG-Fc: 1.22 μg/ml) (Fig. 3F and table S1). We also increased binding valency by grafting a tandem repeat of humanized VHH72 onto human IgG1 Fc, resulting in a tetravalent molecule. With this construct we observed a greater than 100-fold higher apparent affinity for SARS-CoV-2 RBD, and greater than 100-fold higher affinity binding to spike-transfected HEK293S-cells compared with its bivalent counterpart (fig. S7A and C, table S2). In line with this increased binding, the tetravalent construct displayed a 5 to 10 times more potent virus neutralizing activity compared with its bivalent counterpart (Fig. 3F, fig. S7B and E, table S1).

Fig. 3 VHH72_S56A-Fc constructs have increased affinity and SARS-CoV-2 neutralizing activity.

(A) Binding affinity of VHH72-Fc variants to immobilized SARS-CoV-2 RBD fused to mouse Fc is shown. Apparent kinetics of the 2:2 interaction were based on a global 1:1 fit of the replicate (mean, N = 2) data; values are the averages of replicates. (B) Binding of the indicated VHH72-Fc constructs to SARS-CoV-2 spike was quantified by an ELISA. Data points are mean ± SD; N = 2. (C) Binding of the indicated VHH72-Fc constructs to cell surface expressed, transfected, SARS-CoV-2 spike was determined by flow cytometry and shown as the ratio of the mean fluorescence intensity of the GFP-positive over GFP-negative cells. Data points are mean ± SD; N = 2. (D) Inhibition of the ACE2-RBD interaction was determined by AlphaLISA. (E) Inhibition of SARS-CoV-2 RBD binding to Vero E6 cells by the indicated VHH72-Fc constructs was determined by flow cytometry. Data points are mean ± SD; N = 2. (F) Neutralization of authentic SARS-CoV-2 by the indicated VHH72-Fc constructs. Data points in the graph represent the relative mean (± SEM, n=3) number of plaques and are from one experiment that is representative of two independent replicates. (G to I) Hamsters were intraperitoneally injected with 20 mg/kg of palivizumab, humVHH_S56A/LALAPG-Fc or (humVHH)2/WT-Fc and challenged the next day with 2×106 PFU of SARS-CoV-2. Infectious virus in lungs (G) and viral RNA in lungs, ileum and stool (H) were measured on day 4 after challenge. (I) Severity score of dilated bronchi was measured on day 4 after challenge. Data were analyzed with the Kruskal-Wallis test and Dunn’s multiple comparison test (*p<0.05; **p<0.01). Dotted lines in (G) and (H) indicate the lower limit of detection.

We next used the hamster SARS-CoV-2 challenge model to determine the protective potential of these potency-enhanced VHH-Fc fusion intermediate lead molecules. We assessed the protective potential of a prophylactic dose at 20 mg/kg of either bivalent humVHH_S56A/LALAPG-Fc (plaque reduction neutralization test half maximum value (PRNT50) = 0.13 μg/ml) or tetravalent (humVHH)2/WT-Fc (PRNT50 = 0.10 μg/ml) formats, administered one day prior to challenge (Fig. 3G to I). No infectious virus was detectable in lung homogenates from any of the VHH72-Fc treated hamsters except for one outlier (Fig. 3G). Compared with control treated animals, a significant reduction in viral RNA in the lungs (P = 0.0054 and P = 0.0178; > 4 log) and ileum (P = 0,0049 and P = 0.0156; 2 log) was observed in respectively the humVHH_S56A/LALAPG-Fc and (humVHH72)2/WT-Fc treated groups, and in stool samples for humVHH_S56A/LALAPG-Fc (P = 0.0273, Fig. 3H). Protection was also evident based on μ-computer tomography (μCT) imaging of the lungs on day 4 (Fig. 3I). Given the comparable protection outcome, the bivalent and tetravalent designs were both assessed further.
Generation of a lead therapeutic. Robust expression, chemical and physical stability, and absence of atypical posttranslational modifications are important prerequisites for the “developability” of a biologic (35). To maximize the homogeneity, we first truncated the upper hinge of the Fc, in common with most Fc fusions. Mass spectrometry analysis revealed partial C-terminal lysine removal in CHO-produced VHH72-Fc proteins and we therefore removed this codon (fig. S8). Third, to avoid all possibility of N-terminal pyroglutamate formation and its associated charge heterogeneity, we substituted the native N-terminal glutamine residue with an aspartic acid rather than glutamic acid. Analysis of the final designs by intact (reduced) protein and peptide-level liquid chromatography tandem mass spectrometry (LC-MS/MS) showed that the VHH/linker/hinge moieties were homogenous and the Fc had CHO-typical N-glycans (fig. S9) and only well-known chemical modifications that are typical for lab-scale transient transfection produced antibodies: low glycation at 2 lysine residues (fig. S8 and table S3) and a deamidation site (fig. S10 and table S3). Such chemical modifications are limited and controlled for during antibody manufacturing.

All the VHH72-Fc variants were efficiently produced in transiently transfected ExpiCHO cells with yields as high as 1.2 g per liter of cell culture after purification (table S4). The resulting humVHH_S56A/LALAPG-Fc/Gen2 construct displayed similar RBD-binding kinetics and SARS-CoV-2 neutralizing activity as humVHH_S56A/LALAPG-Fc (table S1, and fig. S7E). Combining our two potency-enhancing modalities, we also introduced the S56A mutation in each of the four VHH72 moieties in the tetravalent format in construct (humVHH_S56A)2/LALAPG-Fc/Gen2, which further increased the in vitro antiviral potency, reaching a PRNT50 value of 0.02 μg/ml (a 50-fold improved over the pre-lead parental construct, fig. S7E and table S1). Finally, we also generated hIgG1 LALA variants of the final bivalent sequence design, with or without the S56A VHH mutation (table S1).

All constructs displayed good biophysical properties. Even without any formulation optimization, Dynamic Light Scattering (DLS) analysis of WT-VHH/WT-Fc, for example, at concentrations up to 30 mg/ml in phosphate-buffered saline (PBS) revealed a homogenous sample composition, with only minor amounts of aggregation below the limit of quantification (Fig. 4A). All VHH72-Fc constructs displayed a very low tendency to multimerize or aggregate (Fig. 4B and table S5). Temperature-induced protein unfolding and aggregation was also not affected by the humanization, S56A, or LALA(PG) substitutions. Unfolding and aggregation of the tetravalent formats (humVHH)2/WT-Fc and (humVHH_S56A)2/LALAPG-Fc/Gen2, however, started at lower temperatures (Fig. 4C, fig. S11, and table S6). Even after 10 days of thermal stress at 40°C the humanized VHH72-Fc fusions showed only a very minor tendency to aggregate (Fig. 4D and E and table S6). Additionally, in a polyethylene glycol (PEG) precipitation assay which mimics high concentration solubility, the tetravalent molecule displayed less solubility with increasing PEG concentrations and has a longer retention time on a hydrophobic interaction column (fig. S12). The tetravalent molecule also had a more acidic isoelectric point (pI) making it potentially less favorable for a manufacturing strategy, requiring greater optimization of ion exchange steps (table S7) (36).

Fig. 4 Biophysical properties of VHH72-Fc constructs.

(A) DLS of WT-VHH/WT-Fc at 25°C is shown, at 1.0, 20 or 30 mg/ml in 25 mM His and 125 mM NaCl, pH 6.0. (B) Size exclusion chromatography-multi-angle light scattering (SEC-MALS) is shown for 2 to 4 mg/ml samples of WT-VHH/WT-Fc and variants in which humanization, affinity-increasing (S56A) and LALAPG mutations were introduced (in 25 mM His and 125 mM NaCl, pH6.0). UV, ultraviolet 280 nm wavelength light absorption; MW, molar mass of peak fraction determined by light scattering. (C) Thermostability of the indicated VHH72-Fc constructs is shown. Left: Intrinsic Trp fluorescence as a measure of protein unfolding during a thermal ramp is expressed as barycentric mean (BCM) of the fluorescence intensity at 300 and 400 nm. Right: Protein aggregation during thermal ramp was measured by static light scattering (SLS) at 260 nm. (D) Ten day-storage at 40°C causes no major changes in SEC-MALS profiles of duplicate 1 mg/ml VHH72-Fc variant samples in PBS. (E) SEC-MALS profiles of humVHH_S56A/LALA-Fc/Gen2 run in duplicate (solid and dashed lines) are shown. Complete peaks are indicated in grayscale for quantitative analysis; the peak apex is indicated in black for qualitative analysis. Protein conjugate analysis (calculated molar masses shown for a single replicate) was performed based on the differential extinction coefficients and refractive index values of proteins versus conjugated glycan modifiers. AU, arbitrary units.

VHH72_S56A-Fc constructs protect hamsters against SARS-CoV-2. Next, we evaluated the in vivo efficacy of the S56A-containing fully sequence-optimized bivalent humVHH_S56A/LALAPG-Fc/Gen2 (PRNT IC50 = 0.11 μg/ml) and tetravalent (humVHH_S56A)2/LALAPG-Fc/Gen2 (PRNT IC50 = 0.02 μg/ml) constructs against SARS-CoV-2 challenge. Doses of 20, 7 and 2 mg/kg of humVHH_S56A/LALAPG-Fc/Gen2 or (humVHH_S56A)2/LALAPG-Fc/Gen2 were administered intraperitoneally 4 hours after challenge. Control animals received 20 mg/kg of palivizumab and one group of hamsters received 20 mg/kg of the bivalent construct one day prior to challenge, as a bridge from our previous experiment (Fig. 3 G to I). In nearly all animals, virus replication in the lungs was inhibited in the prophylactic setting as well as in the therapeutic 20 and 7 mg/kg groups (Fig. 5A and B and fig. S13A). Gross lung pathology was lowest in the animals that had been treated with 7 mg/kg of the bivalent construct (Fig. 5C). Viral titers in the nose and throat of the challenged hamsters were also significantly and dose-dependently reduced compared to the palivizumab control group (P = 0.001 and P = 0.0002 in nose and throat, respectively, for 20 mg/kg humVHH_S56A/LALAPG-Fc/Gen2; P = 0.009 and 0.0075 in nose and throat, respectively, for 20 mg/kg (humVHH_S56A)2/LALAPG-Fc/Gen2; P = 0.0454 in throat for 7 mg/kg humVHH_S56A/LALAPG-Fc/Gen2; P = 0.001 and P = 0.0064 in nose and throat, respectively, for 7 mg/kg (humVHH_S56A)2/LALAPG-Fc/Gen2). This indicates that parenteral, post-challenge administration of the VHH-Fc constructs restricts viral replication in the upper and lower respiratory tract of the hamsters (fig. S13B and C).

Fig. 5 Therapeutic administration of VHH72-Fc constructs protects hamsters against SARS-CoV-2 challenge.

(A to C) Hamsters were challenged with 1×104 PFU of BetaCoV/Munich/BavPat1/2020 and 4 hours later injected intraperitoneally with 20, 7, or 2 mg/kg of humVHH_S56A/LALAPG-Fc/Gen2 or (humVHH_S56A)2/LALAPG-Fc/Gen2. The negative control group received 20 mg/kg of palivizumab and hamsters in a prophylactic control group received 20 mg/kg of humVHH_S56A/LALAPG-Fc/Gen2 one day before the challenge. Lung virus loads (A), lung viral RNA copies (B), and gross lung pathology (C) were determined on day 4 after infection. (D and E) Hamsters received an intraperitoneal injection of 7 mg/kg of humVHH_S56A/LALAPG-Fc/Gen2 one day prior to challenge or were treated by intraperitoneal injection of 1 or 7 mg/kg of humVHH_S56A/LALAPG-Fc/Gen2 or (humVHH_S56A)2/LALAPG-Fc/Gen2 16 hours after infection with 2×106 PFU of passage 6 BetaCov/Belgium/GHB-03021/2020. Seven mg/kg of palivizumab served as a negative control. Infectious virus load (D) and viral RNA (E) were measured in the lungs on day 4 after challenge. (F and G) Hamsters were treated with 4mg/kg of palivizumab, humVHH_S56A/LALA-Fc/Gen2 or humVHH/LALA-Fc/Gen2 by intraperitoneal injection 24 hours after challenge with 2×106 PFU of passage 6 BetaCov/Belgium/GHB-03021/2020. Infectious virus (F) and viral RNA (G) were measured in lung tissue on day 4 after infection. Data were analyzed with the Kruskal-Wallis test and Dunn’s multiple comparison test (*P<0.05; **P<0.01; ***P<0.001). Horizontal bars indicate mean. Dotted horizontal lines indicate lower limit of detection.

We independently validated this therapeutic dose finding for the bivalent and tetravalent VHH-Fc fusion lead constructs at 7 and 1 mg/kg at a different laboratory by intraperitoneal injection, 16 hours after challenge with a different SARS-CoV-2 isolate (BetaCov/Belgium/GHB-03021/2020 strain) (Fig. 5D). Infectious virus load in the lungs was significantly reduced compared to the control treated animals for both the humVHH_S56A/LALAPG-Fc/Gen2 (P = 0.0153) and (humVHH_S56A)2/LALAPG-Fc/Gen2 (P = 0.009) treated groups at 7 mg/kg (Fig. 5D). Finally, we conducted a hamster challenge experiment to evaluate the in vivo impact of the S56A mutation in VHH72 in the context of humVHH_S56A/LALA-Fc/Gen2, administered at a dose of 4 mg/kg 24 hours after challenge with the BetaCov/Belgium/GHB-03021/2020 strain. Treatment with humVHH_S56A/LALA-Fc/Gen2 resulted in a stronger reduction in infectious virus and viral genomic RNA in the lungs compared to humVHH/LALA-Fc/Gen2, providing evidence that the increased in vitro affinity and antiviral potency of the S56A mutation in VHH72-Fc also resulted in enhanced protection in vivo (Fig. 5F and G). The concentration of SARS-CoV-2 RBD VHH72-competing antibodies in hamster serum inversely correlated with the infectious virus and viral RNA loads in the lungs of the challenged hamsters (fig. S13D and E). We prioritized the simpler bivalent design and selected humVHH_S56A/LALA-Fc/Gen2 as our clinical lead molecule, which was termed XVR011.
XVR011 lacks off-target binding to human proteins and has reduced FcγR binding. For safe use in humans upon systemic administration, antibodies must have a low propensity for off-target binding to other human membrane/extracellular proteins. To evaluate this for XVR011, we used a human membrane protein microarray assay in which reactivity was probed against fixed HEK293 cells that each overexpress one of 5475 full-length human plasma membrane proteins and cell surface-tethered human secreted proteins and a further 371 human heterodimeric such proteins (37). Only four proteins were found to potentially show some binding in a high-sensitivity primary screen using XVR011 as primary antibody and an anti-human IgG1 secondary detection antibody: overexpressed proteins FCGR1A, IGHG3, IGF1, and CALHM6. In a targeted confirmation experiment, we used the clinically well-validated rituximab (anti-CD20) and cells expressing its antigen as a control for potential hIgG1 Fc-mediated interactions, as well as a buffer control instead of primary antibody. Binding to the primary hits was as low or lower than that of rituximab, and a robust detection signal was only observed for fixed cells that expressed human immunoglobulin heavy gamma-3 chain (IGHG3). However, this reactivity was equally strong with the PBS and rituximab controls and was likely due to direct binding of the secondary detection antibody (fig. S14). Based on these results, we conclude that XVR011 is not polyreactive to human proteins, which supports its potential for safe use as a treatment for COVID-19. We also verified that the introduced LALA mutations in the context of VHH-Fc fusion construct XVR011 resulted in reduced binding to activating Fcγ receptors. Compared to rituximab, XVR011 bound to immobilized FcγRI and FcγRIIIa (V176) with a 2300- and 40-fold lower affinity, whereas binding to FcγRIIa (H167), FcγRIIa (R167), FcγRIIIa (F176), FcγRIIIb, and FcγRIIb was barely detectible and occurred with an estimated apparent equilibrium dissociation constant (KD) of more than 20 μM (fig. S15 and table S8).
HumVHH_S56A/LALA-Fc/Gen2 binds to the RBD of a broad range of Sarbecoviruses and neutralizes circulating SARS-CoV-2 variants. To test the Sarbecovirus binding breadth of humVHH_S56A/LALA-Fc/Gen2, we applied a flow cytometry-based yeast surface display method (23). HumVHH_S56A/LALA-Fc/Gen2 bound to yeast surface displayed RBD of SARS-CoV-2, GD-Pangolin, RaTG13, SARS-CoV-1, LYRa11, and WIV1 (all clade 1) with high affinity. In addition, humVHH_S56A/LALA-Fc/Gen2 could bind the RBD of Rp3 and HKU3-1 (both clade 2) and BM48-31 (clade 3), whereas CB6, which recognizes the RBM (38), and S309, which binds to a conserved site in the RBD core (39), did not bind to these RBDs (fig. S16).
All RBD mutations observed in the current rapidly spreading VOCs are distant from the VHH72 contact region (Fig. 6A). In a flow cytometry assay, our optimized drug lead humVHH_S56A/LALA-Fc/Gen2 showed equally strong binding to wild-type SARS-CoV-2 as well as to SARS-CoV-2 RBD N501Y, K417N, E484K, and K417N + E484K + N501Y SARS-CoV-2 RBD mutants expressed on the surface of mammalian cells in the context of the complete spike of SARS-CoV-1 (Fig. 6B) (40). N501Y is the mutation seen in both the B.1.1.7. (41) and B.1.351 (42) variants, in which the K417N and E484K are combined with it. Binding of humVHH_S56A/LALA-Fc/Gen2 to RBD variant N439K (43), in the periphery of the VHH72 contact region and observed 8661 times as of June 2 2021, was also not affected (Fig. 6B). This is unsurprising as this transition to the positively charged Lys mimics the Arg which is present at this position in SARS-CoV-1, to which VHH72 was raised. In line with these results, humVHH_S56A/LALA-Fc/Gen2 showed equal neutralization potency against authentic SARS-CoV-2 BetaCov/Belgium/GHB-03021/2020, a B.1.1.7. variant with N501Y and a B.1.351 variant carrying K417N, E484K, and N501Y mutations (Fig. 6C).

Fig. 6 humVHH_S56A/LALA-Fc/Gen2 neutralizes SARS-CoV-2 variants of concern.

(A) Surface view of SARS-CoV-2 RBD (gray) with VHH72 (green cartoon) and the N-terminal helixes of ACE2 (blue cartoon). The RBD-residues Lys417, Asn439, Leu452, Glu484, and Asn501 are indicated and marked in orange. (B) Binding of humVHH_S56A/LALA-Fc/Gen2, CB6, and palivizumab to SARS-CoV-1 spike was measured with the RBD replaced by WT, N439K, K417N, E484K, N501Y or (K417N + E484K + N501Y) RBD of SARS-CoV-2 and expressed on the surface of 293T cells. Data points represent the ratio of the MFI of transfected (GFP+) cells over the MFI of non-transfected (GFP) cells, as determined by flow cytometry. (C) Neutralization of authentic SARS-CoV-2 virus determined by plaque reduction neutralization assay with three-fold serial dilutions of the indicated VHH-Fc fusion constructs using BetaCov/Belgium/GHB-03021/2020, B1.1.7, or B.1.351 variant viruses.

DISCUSSION

There remains a need for safe and effective anti-SARS-CoV-2 drugs that can prevent or treat COVID-19. Here, we report the protein engineering-based drug development of a potent cross-neutralizing, VOC-resistant anti-COVID-19 biologic. This biologic was based on a humanized, in silico affinity-enhanced VHH72 variant, which, in bivalent and tetravalent VHH-Fc format, demonstrates strong anti-viral efficacy in a hamster challenge model. Compared with conventional human monoclonal antibodies, the VHH-Fc fusion construct is smaller (80 kDa versus 150 kDa) and encoded by a single gene, giving advantages with respect to dosing and manufacturability. For example, the almost two times smaller size of a VHH-Fc is a considerable advantage for subcutaneous formulations, where a very high molarity of the antibody drug needs to be provided in a small (1 to 2 ml) volume that is feasible for injection via that route. Furthermore, the single-gene encoded nature of the VHH-Fc format, as well as its simpler homodimer assembly pathway, allow for manufacturing in alternative microbial host systems such as yeast. Such a microbial expression system comes with considerably lower cost of goods and rapid pandemic response re-manufacturing opportunities.

Most of the conventional human neutralizing antibodies that are being assessed in clinical trials have been selected from convalescent repertoires. The vast majority of neutralizing antibodies in convalescent plasma are targeting the RBM in the RBD and sites on the N-terminal domain (NTD), which are hence experiencing the majority of antibody-mediated selective pressure (44). Not surprisingly, such antibodies are now affected by mutations in emerging new SARS-CoV-2 VOCs such as in strains classified in the lineages B.1.1.7, B.1.351 (45), and P.1 (46), with the latter two allowing escape from naturally acquired or spike vaccine-induced antibody neutralization. Efforts to develop a pan-Sarbecovirus-neutralizing antibody, such as the VHH72-based biologic described here, are therefore warranted to help protect against disease caused by the current SARS-CoV-2 pandemic virus, future SARS-CoV-2 VOCs, and potentially against future SARS-like coronavirus outbreaks.
The VHH72 discovery, determination of its complex structure bound to the SARS-CoV-1 RBD (13) and demonstration of its antiviral potency as Fc-fusion was first to establish that antibody binding to its non-RBM epitope region of the RBD and, at the same time, also occluding ACE2 binding to the RBM, leads to potent neutralization of Sarbecoviruses such as SARS-CoV-1 and -2. The functional constraints in the VHH72 binding region (inter-RBD interactions in prefusion spike, interactions with the helix-loop-helix in S2) can explain its strong conservation across the Sarbecoviruses. Meanwhile, a few other mAbs and VHHs, which also bind to the VHH72 core epitope (Y369, F377, K378), have been reported (21, 22, 4751), with anti-SARS-CoV-2 potency correlating with strength of competition with ACE2 binding. The much lower immunogenicity of the VHH72 binding region in humans than the epitopes on the RBM is also consistent with a recent large-scale serological survey of convalescent SARS-CoV-2 patients, which demonstrated that mAbs with epitopes strongly overlapping that of VHH72 (site II in that study) were competed against much less potently and were present in a smaller proportion of patient sera than was the case for mAbs targeting the ACE2-binding region of the RBD (47). These results were very similar to what was observed for S309, which is also a SARS-CoV-1/2 cross-neutralizing antibody in clinical development (39). Amongst these binding agents presently described against this ‘cryptic supersite’, XVR011 best combines a very strong potency both in vitro and in vivo, SARS-CoV-1 and -2 cross-neutralization, very broad cross-clade Sarbecovirus binding, and unaltered potency against current VOCs, warranting its clinical development.
We considered it prudent in patients with progressing COVID-19 disease to mainly rely on a pure virus neutralization mechanism of action, and thus to suppress Fcγ receptor binding of the antibody’s Fc domain. To silence antibody Fc-mediated effector functions, we settled on the IgG LALA-Fc mutations, which are amongst the best-validated for this purpose (33). Antibodies that bind to epitopes that overlap with the epitope of VHH72 by nature already have very low Fcγ receptor activating capacity or complement-dependent cytotoxicity. Possibly, this is because this RBD region is not sterically accessible in the dominant closed spike conformation of the native spike protein and thus antibodies that bind to the VHH72 epitope, which requires the open spike conformation with two of the RBDs in the “up” position, may not reach a sufficiently high density to trigger Fcγ receptors or complement activation (47, 52).
It was recently reported that in a therapeutic setting, some human neutralizing antibodies require intact Fc effector functions to control SARS-CoV-2 replication in the K18-hACE2 transgenic mouse and hamster challenge models (53). In contrast to that report, we found that Fc effector silent humVHH_S56A/LALA(PG)-Fc/Gen2 administered 4, 16, or 24 hours after viral challenge resulted in a very strong reduction of lung viral RNA and infectious virus. This suggests that the non-RBM binding mode of neutralization, likely including spike destabilization, perhaps combined with a faster biodistribution compared with a conventional antibody, allows for efficacious viral control (54). The requirement of effector functionality for therapeutic efficacy appears to be very antibody-dependent even with human antibodies, as a recent study also demonstrated therapeutic efficacy in the same hamster model of other RBM-binding LALAPG-modified antibodies (55).

Our study has several limitations. Although the binding region of VHH72 in SARS-CoV-2 RBD is highly conserved, suggesting a functional constraint for this part of the RBD, in vitro escape selection experiments are needed to estimate the likelihood of the emergence and fitness of mutant viruses with reduced susceptibility to XVR011. Second, although we demonstrated in vivo protection against challenge with three different SARS-CoV-2 virus strains, these were all derived from clinical isolates that circulated early in the pandemic. Finally, the safety and effectiveness of XVR011 in COVID-19 patients has not yet been demonstrated. Healthy volunteer Phase 1a trial and a Phase 1b/2 trial in patients with moderate disease severity are presently ongoing to address this question.

The pharmaceutically fully developed VHH72-based biologic named XVR011, that combines potent neutralizing activity with high stability, broad coverage and silenced Fc effector functionality for enhanced safety, has currently completed cGMP-manufacturing and formal preclinical development. Clinical studies are now being started to evaluate safety and efficacy of rapid administration upon hospitalization of patients within the first week of COVID-19 symptoms (NCT04884295). In conclusion, XVR011 represents a promising antibody-based countermeasure against disease caused by SARS-CoV-2 and potential future zoonotic outbreaks with related Sarbecoviruses.

MATERIALS AND METHODS

Study design. This study was designed to generate a candidate VHH72-Fc-based biologic, that is ready for clinical development. We used structure-guided molecular modelling combined with a rapid yeast-based screening approach to identify VHH72-Fc derivatives with enhanced affinity for SARS-CoV-2 RBD. Tandem repeats of VHH72 fused to human IgG1 Fc were generated as an alternative strategy to increase the affinity for SARS-CoV-2 RBD. VHH72 frame work regions were humanized, linkers between the VHH and human IgG1 Fc were optimized, and we opted for an Fc domain with mutations that reduce Fc effector functions and CHO cells for recombinant protein expression. Mass-spectrometry, dynamic light scattering, a polyethylene glycol protein solubility assay and hydrophobic interaction chromatography analysis were performed to select the VHH-Fc candidates with optimal physico-chemical properties. Lack of non-specific antigen binding was demonstrated using a human membrane protein microarray assay and surface plasmon resonance was used to show reduced FcγR binding of the mutated Fc. Candidate VHH72-Fc derivatives for further development were also compared in in vitro virus neutralization assays using VSV pseudotyped with SARS-CoV-1 and -2 spike and authentic SARS-CoV-2 virus, including VOCs.

Prophylactic and therapeutic activity of selected VHH72-Fc constructs were assessed in SARS-CoV-2 challenged K18-hACE2 transgenic mice and hamsters. The sample size of the K18-hACE2 transgenic mice was estimated based on experience with other respiratory viruses to give statistical power while minimizing animal use. Experimentalists involved in the mouse studies were not blinded, because objective measurements were used. To evaluate antiviral activity in the hamster model, we wanted to detect at least 1 log reduction of viral RNA in treated compared to untreated infected control animals. The group size was calculated based on the independent t test with an effect size of 2.0 and a power of 80% (effect size = delta mean/SD = 1 log decrease in viral RNA/0.5 log), resulting in 6 animals/group. The sample sizes were maximized considering the limits in the BSL3 housing capacity and the numbers of animals that can be handled under BSL3 conditions. All caretakers and technicians involved in the hamster studies were blinded to group allocation in the animal facility, and to sample numbers for analysis (qPCR, titration, and histology).

Molecular modeling of the VHH-72 (mutant) interaction with SARS-CoV-2 RBD. Molecular Dynamics simulations were with model-complexes of VHH72 (chain C from pdb-entry 6WAQ) and variants, with the outward-positioned RBD from the cryo-EM structure pdb-entry 6VSB of the SARS-CoV-2 prefusion spike glycoprotein (chain A, residues 335-528). The missing loops at residues 444-448, 455-490 and 501-502 in the cryo-EM RBD were reconstructed from the I-TASSER SARS-CoV-2 RBD model (24) and the missing residues were added by the use of Swiss-PDBViewer (25). Simulations of the VHH72(mutant)-RBD complex were with Gromacs version 2020.1 (26) using the Amber ff99SB-ILDN force field (56) and were run for 5 ns. After conversion of the trajectory to PDB-format, snapshots were extracted every 0.5 ns and were submitted to the FastContact 2.0 server (20) for binding energy calculations.
Escherichia coli and Pichia pastoris strains. Escherichia coli (E. coli) MC1061 or DH5α were used for standard molecular biology manipulations. The Pichia pastoris (syn. Komagataella phaffi) NRRL-Y 11430 OCH1 function-inactivated strain used for VHH-Fc screening (P. pastoris OCH1) was obtained by CRISPR-Cas9 engineering (57). As reported before, the inactivation of the α-1,6-mannosyltransferase encoded by OCH1 results in secretion of more homogenously glycosylated protein carrying mainly Man8 glycan structure (58).
Modular generation of expression plasmids. The expression vectors for all the VHH72-XXX-hFc muteins were generated using an adapted version of the Yeast Modular Cloning toolkit based on Golden Gate assembly (59). Briefly, coding sequences for the S. cerevisiae α-mating factor minus EA-repeats (P3a_ScMF-EAEAdeleted), SARS-VHH72 mutants (P3b_SARS_VHH72-xxx) and human IgG1 hinge-human IgG1 Fc (P4a_(GGGGS)x2hIgG1.Hinge-hIgG1.Fc) were codon optimized for expression in P. pastoris using the GeneArt (Thermo Fisher Scientific) or IDT proprietary algorithm and ordered as gBlocks at IDT (Integrated DNA Technologies BVBA, Leuven, Belgium). Each coding sequence was flanked by unique part-specific upstream and downstream BsaI-generated overhangs. The gBlocks were inserted in a universal entry vector via BsmBI assembly which resulted in different “part” plasmids, containing a chloramphenicol resistance cassette. Plasmids parts were assembled to form expression plasmids (pX-VHH72-xxx-hIgGhinge-hIgGFc) via a Golden Gate BsaI assembly. Each expression plasmid consists of the assembly of 9 parts: P1_ConLS, P2_pGAP, P3a_ScMF-EAEAdeleted, P3b_SARS_VHH72-xxx, P4a_(GGGGS)x2hIgG1.Hinge-hIgG1.Fc, P4b_AOX1tt, P5_ConR1, P6-7_Lox71-Zeo, and P8_AmpR-ColE1-Lox66. Selection was in LB supplemented with 50 μg/ml carbenicillin and 50 μg/ml Zeocin®. All the part and expression plasmids were sequence verified. Transformations of linearized expression plasmids (AvrII) were performed using the lithium acetate electroporation protocol as described (60).

Protein expression and purification. P. pastoris cultures were grown in liquid YPD (1% yeast extract, 2% peptone, 2% D-glucose) or on solid YPD-agar (1% yeast extract, 2% peptone, 2% D-glucose, 2% agar) and selected with 100 μg/ml Zeocin® (InvivoGen). For small scale expression screening, 2-3 single colonies of P. pastoris OCH1 transformed with pX-VHH72-xxx-hIgGhinge-hIgGFc were inoculated in 2 ml BMDY (1% yeast extract, 2% peptone, 100 mM KH2PO4/K2HPO4, 1.34% YNB, 2% D-glucose, pH 6) or BMGY (same composition but with 1% glycerol replacing the 2% D-glucose) in a 24 deep well block. After 50 hours of expression in a shaking incubator (28°C, 225 rpm), the medium was collected by centrifugation at 1.500 g, 4°C for 5 min. Protein expression was evaluated on Coomassie-stained SDS-PAGE of crude supernatant. Crude supernatant was used immediately for analytics purposes (biolayer interferometry and mass spectrometry, see below) or stored at -20°C.

VHH72-Fc constructs were produced in ExpiCHO cells (Thermo Fisher Scientific) by transient transfection of the respective expression plasmids. 25 ml cultures with 6 x106 cells/ml were grown at 37°C and 8% CO2 and transfected with 20 μg of pcDNA3.3-based plasmid DNA using ExpiFectamine CHO reagent. Twenty four hours after transfection, 150 μL of ExpiCHO enhancer and 4 mL of ExpiCHO feed was added to the cells, and the cells were further incubated at 32°C and 5% CO2. Transfected cells were fed a second time 5 days post-transfection. As soon as cell viability had dropped below 75%, the culture medium was harvested. The VHH72-Fc constructs were purified from the clarified culture medium using a 5 ml MabSelect SuRe column (GE Healthcare). After a wash step with McIlvaine buffer pH 7.2, bound proteins were eluted using McIlvaine buffer pH 3. The eluted protein-containing fractions were neutralized with a saturated Na3PO4 buffer. These neutralized fractions were then pooled, and loaded onto a HiPrep Desalting column for buffer exchange into storage buffer (25 mM L Histidine, 125 mM NaCl pH 6) or onto a HiLoad 16/600 Superdex 200 pg size-exclusion column (GE-Healthcare) calibrated with phosphate-buffered saline (PBS) or storage buffer. Where data are labeled as ‘XVR011’, protein material manufactured from a stable CHO cell line has been used in the experiments, of identical sequence as humVHH_S56A/LALA-Fc/Gen2 (which is the naming we use for the protein produced in ExpiCHO transient transfection).

Open reading frames corresponding to the light and heavy chains of the hIgG1 anti-SARS-CoV-2 antibody S309 were ordered synthetically at IDT. For both, an optimized Kozak sequence was added upstream of the start codon. The secretion signal of a Mus musculus Igκ chain was used to direct secretion of the S309 light chain and of a Mus musculus IgG heavy chain to direct secretion of the S309 heavy chain. The carboxy-terminal lysine residue of the S309 heavy chain was omitted. The synthetic DNA fragments were solubilized in ultraclean water at a concentration of 20 ng/μl, A-tailed using the NEBNext-dA-tailing module (NEB), purified using CleanPCR magnetic beads (CleanNA), and inserted in pcDNA3.3-TOPO vector (ThermoFisher). The ORF of positive clones was sequence verified and pDNA of selected clones was prepared using the NucleoBond Xtra Midi kit (Machery-Nagel). Expression in ExpiCHO cells and purification of S309 was performed as described above for the VHH72-Fc constructs except that for S309 the heavy chain and light chain encoding plasmids were mixed in a ratio of 1:2. CB6 (heavy chain GenBank MT470197, light chain GenBank MT470196) was custom produced in a mammalian cell system by Genscript.

Biolayer interferometry (BLI). The SARS-CoV-2 RBD binding kinetics of VHH72-hIgG1Fc affinity optimized variants in P. pastoris supernatant were assessed via biolayer interferometry on an Octet RED96 system (FortéBio). Anti-mouse IgG Fc capture (AMC) biosensors (FortéBio) were soaked in kinetics buffer (10 mM HEPES pH 7.5, 150 mM NaCl, 1 mg/ml bovine serum albumin, 0.05% Tween-20 and 3 mM EDTA) for 20 min. Mouse IgG1 Fc fused SARS-CoV-2 RBD (Sino Biological, 40592-V05H) at 5-15 μg/ml was immobilized on these AMC biosensors to a signal of 0.3-0.8 nm. Recombinant protein concentrations in crude cell supernatants of VHH72-hFc expressing P. pastoris OCH1 were estimated based on band intensity on Coomassie-stained SDS-PAGE as compared to a purified VHH-hFc protein. Crude supernatants were diluted 20 to 100-fold in kinetics buffer to an approximate VHH72-hFc affinity mutant concentration of 5-10 nM. Association was measured for 180 s and dissociation for 480 s in similarly diluted supernatant of a non-transformed P. pastoris culture. Between analyses, biosensors were regenerated by three times 20 s exposure to regeneration buffer (10 mM glycine pH 1.7). Using ForteBio Data Analysis 9.0 software, data were double reference-subtracted and the decrease of response signal during dissociation was determined. To measure the affinity of monovalent VHH72 variants for RBD, monomeric human Fc-fused SARS-CoV-2_RBD-SD1 (27) at 15 μg/ml was immobilized on anti-human IgG Fc capture (AHC) biosensors (FortéBio) to a signal of 0.35-0.5 nm. In an alternative setup, mouse IgG1 Fc fused SARS-CoV-1 RBD (Sino Biological, 40150-V05H) or SARS-CoV-2 RBD (Sino Biological, 40592-V05H) at 15 μg/ml was immobilized on AMC biosensors (ForteBio). Association (120 s) and dissociation (480 s) of two-fold dilution series starting from 200 nM VHH72 variant in kinetics buffer were measured. To assess full apparent binding kinetics of purified bivalent VHH72-hFc variants, bivalent mouse IgG1 Fc fused SARS-CoV-2-RBD (Sino Biological, 40592-V05H) at 15 μg/ml was immobilized on AMC biosensors to a signal of 0.4-0.6 nm. Association (120 s) and dissociation (480 s) of twofold serial dilutions starting from 30 nM VHH72-hFc variants in kinetics buffer were measured. Between analyses of binding kinetics, AHC and AMC biosensors were regenerated by three times 20 s exposure to regeneration buffer (10 mM glycine pH 1.7). Data were double reference-subtracted and aligned to each other in Octet Data Analysis software v9.0 (FortéBio) based on a baseline measurement of a non-relevant VHH-IgG1 Fc fusion protein (for kinetics of VHH72-hFc variants) or kinetics buffer (for kinetics of monovalent VHHs). Association and dissociation of non-saturated curves (both 1:1 kinetics of monovalent VHHs and 2:2 and 4:4 kinetics of bi- and tetravalent VHH-hFc variants) were fit in a global 1:1 model.
SEC-MALS. To determine the molecular mass and aggregation behavior of VHH72-hFc variants, the protein was analyzed by size exclusion chromatography multi-angle laser light scattering (SEC-MALS). For each analysis, 100 μl sample filtered through 0.1 μm Ultrafree-MC centrifugal filters (Merck Millipore) was injected onto a Superdex 200 Increase 10/300 GL Increase SEC column (GE Healthcare) equilibrated with sample buffer, coupled to an online UV detector (Shimadzu), a mini DAWN TREOS (Wyatt) multi-angle laser light scattering detector and an Optilab T-rEX refractometer (Wyatt) at 298 K. The refractive index (RI) increment value (dn/dc value) at 298 K and 658 nm was calculated using SEDFIT v16.1 (61) and used for the determination of the protein concentration and molecular mass. Glycoprotein conjugate analysis was performed using a value of 0.140 ml/g for dn/dcglycan (average carbohydrate dn/dc (62)) and a UV extinction coefficient of zero to account for the negligible absorbance of glycans at 280 nm. Data analysis was carried out using the ASTRA 7.3.2 software.
SARS-CoV pseudovirus neutralization assay. To generate replication-deficient VSV pseudotyped viruses, HEK293T cells, transfected with SARS-CoV-1 S or SARS-CoV-2 S were inoculated with a replication deficient VSV vector containing eGFP and firefly luciferase expression cassettes (63, 64). After a 1 hour incubation at 37°C, the inoculum was removed, cells were washed with PBS and incubated in media supplemented with an anti-VSV G mAb (ATCC) for 16 hours. Pseudotyped particles were then harvested and clarified by centrifugation (13). For the VSV pseudotype neutralization experiments, the pseudoviruses were incubated for 30 min at 37°C with different dilutions of purified VHH or VHH-Fc fusions or with GFP-binding protein (GBP: a VHH specific for GFP). The incubated pseudoviruses were subsequently added to subconfluent monolayers of Vero E6 cells. Sixteen hours later, the cells were lysed using passive lysis buffer (Promega). The transduction efficiency was quantified by measuring the GFP fluorescence in the prepared cell lysates using a Tecan infinite 200 pro plate reader. GFP fluorescence was normalized using either the GFP fluorescence of non-infected cells and infected cells treated with PBS or the lowest and highest GFP fluorescence value of each dilution series. The IC50 was calculated by non-linear regression curve fitting, log(inhibitor) vs. response (four parameters).
SARS-CoV-2 plaque reduction neutralization test (PRNT). The PRNT results shown in Fig. 2f, Supplementary Fig. 6e, and Supplementary Table 1 were performed with SARS-CoV-2 strain BetaCov/Belgium/GHB-03021/2020 (EPI ISL 407976; 2020-02-03) used from passage P6 grown on Vero E6 cells (14). SARS-CoV-2 viruses belonging to the VoC UK and South African lineages B.1.1.7 (hCoV-19/Belgium/rega-12211513/2020; EPI_ISL_791333, 2020-12-21) and B.1.351 (hCoV-19/Belgium/rega-1920/2021; EPI_ISL_896474, 2021-01-11) were each isolated from nasopharyngeal swabs taken from travelers returning to Belgium in December 2020 and January 2021, respectively, and have recently been described (65). B.1.1.7 was from a healthy subject and B.1.351 from a patient with respiratory symptoms. Passage 2 B.1.1.7. and B.1.351 virus stocks were grown on Vero E6 cells and median tissue culture infectious doses (TCID50) defined by titration using the Spearman-Kärber method (66). Passage 0 and 2 B.1.1.7 and B.1.351 virus preparations had identical genome sequences.

Dose-dependent neutralization of distinct VHH-Fc constructs was assessed by mixing the VHH-Fc constructs at different concentrations (three-fold serial dilutions starting from a concentration of 20 μg/ml), with 100 PFU SARS-CoV-2 in DMEM supplemented with 2% FBS and incubating the mixture at 37°C for 1h. VHH-Fc-virus complexes were then added to Vero E6 cell monolayers in 12-well plates and incubated at 37°C for 1h. Subsequently, the inoculum mixture was replaced with 0.8% (w/v) methylcellulose in DMEM supplemented with 2% FBS. After 3 days incubation at 37°C, the overlays were removed, the cells were fixed with 3.7% PFA, and stained with 0.5% crystal violet. Half-maximum neutralization titers (PRNT50) were defined as the VHH-Fc concentration that resulted in a plaque reduction of 50% across 2 or 3 independent plates.

Flow cytometric analysis of antibody binding to Sarbecovirus RBD displayed on the surface of Saccharomyces cerevisiae. A pool of plasmids, based on the pETcon yeast surface display expression vector, that encode the RBDs of a set of SARS-CoV2 homologs was generously provided by Dr. Jesse Bloom (23). This pool was transformed to E. coli TOP10 cells by electroporation at the 10 ng scale and plated onto low salt LB agar plates supplemented with carbenicillin. Single clones were selected, grown in liquid low salt LB supplemented with carbenicillin and miniprepped. Selected plasmids were Sanger sequenced with primers covering the entire RBD coding sequence and the process was repeated until every desired RBD homolog had been picked up as a sequence-verified single clone. Additionally, the CDS of the RBD of SARS-CoV2 was ordered as a yeast codon-optimized gBlock and cloned into the pETcon vector by Gibson assembly. The plasmid was transformed into E. coli, prepped and sequence-verified as described above. DNA of the selected pETcon RBD plasmids was transformed to Saccharomyces cerevisiae strain EBY100 according to the protocol by Gietz and Schiestl (67) and plated on yeast drop-out medium (SD agar -trp -ura). Single clones were selected and verified by colony PCR for correct insert length. A single clone of each RBD homolog was selected and grown overnight in 10 ml of liquid repressive medium (SRaf -ura -trp) at 28°C. These precultures were then back-diluted to 50 ml of liquid inducing medium (SRaf/Gal -ura -trp) at an OD600 of 0.67/ml and grown for 16 hours before harvest. After washing in PBS, the cells were fixed in 1% PFA, washed twice with PBS, blocked with 1% BSA and stained with dilution series of anti-RBD antibodies or palivizumab. Binding of the antibodies was detected using Alexa fluor 633 conjugated anti-human IgG antibodies (Invitrogen). Expression of the surface-displayed myc-tagged RBDs was detected using a FITC conjugated chicken anti-myc antibody (Immunology Consultants Laboratory, Inc.). Following 3 washes with PBS containing 0.5% BSA, the cells were analyzed by flow cytometry using an BD LSRII flow cytometer (BD Biosciences). The binding curves were fitted using nonlinear regression (Graphpad 8.0).

Mouse challenge experiments. Transgenic (K18-hACE2)2Prlmn mice were originally purchased from The Jackson Laboratory. Locally bred hemizygous 10-14-week-old animals of both sexes were used for experiments. Infection experiments were performed in accordance with the guidelines of the Federation for Laboratory Animal Science Associations and the national animal welfare body. All experiments were in compliance with the German animal protection law and approved by the animal welfare committee of the Regierungspräsidium Freiburg (permit G-20/91).

WT-VHH/12GS-WT-Fc treatments were performed either by injecting approximately 500 μl of a 250 μg/ml solution of WT-VHH/12GS-WT-Fc into the peritoneum of non-anesthetized mice to reach a dose of 5 mg/kg or by applying 40 μl of the WT-VHH/12GS-WT-Fc at 1 mg/ml to the nostrils of isoflurane-anesthetized mice. Infection of isoflurane-anesthetized mice with 8 × 103 PFU of a clinical SARS-CoV-2 isolate (Muc-IMB-1/2020) was done by applying 40 μl samples to the nostrils. Infected mice were monitored for weight loss and clinical signs of disease for 14 days. Mice were euthanized by cervical dislocation on day 3 post infection to determine infectious virus in lungs by plaque assay using Vero E6 cells. Infected mice were euthanized and scored dead if they lost 25% of their initial body weight or if showing severe signs of disease. All infection experiments were performed under BSL3 conditions.

Hamster challenge experiments. The hamster infection model of SARS-CoV-2 performed in the Neyts lab, including the associated analytical procedures, has been described before (68). In brief, female Syrian hamsters (Mesocricetus auratus) of 6-8 weeks’ old were anesthetized with ketamine/xylazine/atropine and inoculated intranasally with 50 μL containing 2×106 TCID50 SARS-CoV-2 BetaCov/Belgium/GHB-03021/2020. Animals were treated once by intraperitoneal injection, either 1 day prior or 16-24h post SARS-CoV-2 challenge. Hamsters were monitored daily for appearance, behavior and weight. At day 4 pi, hamsters were euthanized by i.p. injection of 500 μL Dolethal (200mg/ml sodium pentobarbital, Vétoquinol SA). Lung, ileum and stool were collected and viral RNA and infectious virus were quantified by RT-qPCR and end-point virus titration, respectively. Serum samples were collected at day 4 pi for PK analysis. Micro-CT data of in vivo hamster lungs were acquired using dedicated small animal micro-CT scanners, either using the X-cube (Molecubes, Ghent, Belgium) or the Skyscan 1278 (Bruker Belgium, Kontich, Belgium), as described earlier (68). Visualization and quantification of reconstructed micro-CT data were performed with DataViewer and CTan software (Bruker Belgium). Housing conditions and experimental procedures were approved by the ethics committee of animal experimentation of KU Leuven (license P065-2020).

The hamster model performed at Viroclinics was as follows. Male 14-15 weeks old Syrian hamsters (Mesocricetus auratus), weighing 106 to 158 g were obtained from Janvier. The animals were housed for 7 days in individually ventilated cages (2 hamsters per cage) under BSL-2 conditions prior to transfer to a BSL-3 animal house. Six animals were used per group. Palivizumab (20 mg/kg), humVHH_S56A/LALAPG-Fc/Gen2 (20, 7, and 2 mg/kg) and (humVHH_S56A)2/LALAPG-Fc/Gen2 (20, 7 and 2 mg/kg) were administered by intraperitoneal injection in a volume of 1ml per 100 g of hamster body mass 4 hours after the challenge. One group of hamsters received 20 mg/kg of humVHH_S56A/LALAPG-Fc/Gen2 by intraperitoneal injection 24 hours before challenge infection. All animals were infected intranasally with 104 TCID50 of SARS-CoV-2 BetaCoV/Munich/BavPat1/2020 (Passage 3, grown on Vero E6 cells) in a total volume of 0.1 ml. On day 4 after infection all animals were euthanized by exsanguination under anesthesia.

Ethics approval for the hamster study performed at Viroclinics was registered under number: 277002015283-WP11. On day 2 after infection, throat swabs were collected in 1.5 ml virus transport medium (EMEM containing bovine serum albumin (fraction V), penicillin, streptomycin, amphothericin-B, L-glutamine, sodium bicarbonate and Hepes), aliquoted and stored. Upon necropsy, broncho alveolar lavage was performed on the left lung with 1ml of PBS and tissue samples were collected and stored in 10% formalin for histopathology and immunohistochemistry (left lung and left nasal turbinate) and frozen for virological analysis (right lung and right nasal turbinate). For virological analysis, tissue samples were weighed, homogenized in infection medium and centrifuged briefly before titration. Serum samples on day 4 (approximately 500 μl per animal) post infection were collected during euthanization and immediately transferred to appropriate tubes containing a clot activator (Microvette 500 Z-Gel, Sarstedt, Germany). Throat swabs, BAL and tissue homogenates were used to detect viral RNA. To this end, RNA was isolated (nucleic acid purification on the MagNA Pure 96; Roche Life Science), reverse transcribed and Taqman PCR (on the 7500 RealTime PCR system; Applied Biosystems) was performed using specific primers (E_Sarbeco_F: 5′ACAGGTACGTTAATAGTTAATAGCGT3′ and E_Sarbeco_R: 5′ATATTGCAGCAGTACGCACACA3′) and probe (E_Sarbeco_P1: 5′ACACTAGCCATCCTTACTGCGCTTCG3′) specific for betacoronavirus E gene. Quadruplicate 10-fold serial dilutions were used to determine the virus titers in confluent layers of Vero E6 cells. To this end, serial dilutions of the samples (throat swabs, BAL and tissue homogenates) were made and incubated on Vero E6 monolayers for 1 hour at 37 degrees. Vero E6 monolayers were then washed and incubated for 4-6 days at 37 degrees after which plates were stained and scored using the vitality marker WST8 (colorimetric readout). To this end, WST-8 stock solution was prepared and added to the plates. Per well, 20 μL of this solution (containing 4 μL of the ready-to-use WST-8 solution from the kit and 16 μL infection medium, 1:5 dilution) was added and incubated 3-5 hours at RT. Subsequently, plates were measured for optical density at 450 nm (OD450) using a microplate reader and visual results of the positive controls (cytopathic effect (cpe)) were used to set the limits of the WST-8 staining (OD value associated with cpe). Viral titers (TCID50/ml or/g) were calculated using the method of Spearman-Karber (66).

Statistical analysis. Normal distribution of the data was tested by a Shapiro-Wilk test and differences in variance among groups with normally distributed data was tested by an F test. For statistical analyses in which two groups with normally distributed data were compared an unpaired student’s t test was used. Welsh’s correction was applied for groups with significant difference in variance. When multiple groups with normally distributed data and no significant differences in variance were compared to the control group a 1-way ANOVA test and a Dunnet’s multiple comparisons test was used for post hoc analysis to correct for multiple comparisons. When multiple groups with not normally distributed data were compared to the control group a Kruskal-Wallis test and a Dunn’s multiple comparisons test was used for post hoc analysis to correct for multiple comparisons. Differences in bodyweight between two groups was tested by 2-way ANOVA with Sidak’s multiple comparison. Differences in survival were tested with a log-rank (Mantel-Cox) test. All statistical analysis was done using GraphPad Prism 9.10.

Acknowledgments

We are grateful to Gert Zimmer, Stefan Pöhlmann and Markus Hoffmann for providing reagents to generate VSV pseudotype particles, Jason McLellan and Daniel Wrapp for providing SARS-CoV-2 spike and RBD proteins and expression plasmids for these proteins, Jesse Bloom for providing the S. cerevisiae RBD display library, and Vincent Munster and Michael Letko for providing chimeric SARS-CoV-1 spike expression constructs. We thank Nadja van Boxel and Joana Reis Pedro for excellent technical assistance in the generation of humanized VHHs, stability and functional characterization, and pharmacokinetic assessments. We thank Leon de Waal from Viroclinics for coordinating the hamster challenge study. We thank Carolien De Keyzer, Lindsey Bervoets, Elke Maas, Thibault Francken, Tina Van Buyten, Jasper Rymenants and Kathleen Van den Eynde for excellent technical assistance in the hamster challenge studies. We thank Valentijn Vergote and Elisabeth Heylen for facilitating the animal studies. We are grateful to Hanna Hailu and Sarfaraj Topia for material generation, purification and distribution. We thank Oliver Zaccheo and Bruce Carrington for helpful advice in the conducting of the FcγR binding studies. We thank the staff of the VIB Flow Core Ghent for providing access to flow cytometry equipment and their support with flow cytometry experiments. We thank the VIB Protein Service Facility and Savvas Savvides for making multi-angle light scattering (MALS) and biolayer interferometry (BLI) equipment available. We acknowledge all Global initiative on sharing all influenza data (GISAID) contributors for their sharing of sequencing data. We thank the entire teams at VIB-Center for Medical Biotechnology, VIB Innovation and Business, VIB Discovery Sciences and UCB for support.

Funding: This work was supported by a PhD fellowship of the Fund for Scientific Research Flanders (FWO) to SDC, CL, HE, DVH, SC, GDM, WW, and SJ; a junior postdoctoral fellowship of the FWO to IRo; a China Scholarship Council grant (grant No.201906170033) to XZ; by FWO projects VIREOS (EOS ID: 30981113) and G0B1917N to XS; FWO project G0G4920N to NC; UGent GOA and BOF projects to XS and NC; VUB grant OZR3571 to ND; and the Bundesministerium fuer Bildung und Forschung (BMBF) through the Deutsches Zentrum für Luft- und Raumfahrt (DLR, grant number 01KI2077) to MS and PS.

Author contributions: BS, LvS, WN, KR, FP, PS, MS, ND, DT, MG, JH, AH, AP, ME, KB, AT, BD, CS, JN, NC, and XS conceptualized the study. BS, LvS, WN, KR, DF, SD, DS, CSF, RA, SJFK, JR-P, DJ, LD, RB, HJT, KD, FP, PS, ND, DT, AH, AP, KB, ME, AT, BD, CS, JN, NC, and XS conceptualized the methodology. BS, LvS, WN, KR, DF, SD, WW, JBo, AFO, LS, GVV, BG, JBe, DS, IRe, CSF, RA, SJFK, JR-P, DJ, LD, PS, ND, DT, MG, AH, AP, AT, BD, CS, JN, NC, and XS performed the formal analysis. BS performed VSV pseudotype and XZ and RB SARS-CoV-2 virus neutralization assays. LsV and JBo performed affinity and protein stability assays. WN and FP performed molecular modeling. KR, SV, and KS produced and purified recombinant proteins from CHO cells. SD, WW, and AVH performed experiments using mass spectrometry and N-glycan analysis. WVB, SDC, DVH, JPC, SC, DDV, GM, JCZM, and GDM performed molecular cloning experiments. ME designed and generated final expression constructs (molecular cloning). DF analyzed SARS-CoV-2 RBD sequence diversity. JH performed polyethylene glycol solubility and hydrophobic interaction chromatography assays. B.S., LvS, CL, HE, and IRo performed yeast expression and RBD-display experiments. JBe, DS, PS, and AO performed experiments with K18-hACE2 transgenic mice. LLa, SJ, StH, LLi, RB, HJT, CSF, RA, and SJFK performed hamster challenge experiments. PM isolated, cultured, characterized and provided SARS-CoV-2 viruses. BS, LvS, WN, KR, SD, WW, and DS performed data analysis and presentation. DS, NC, and XS. BS, LvS, WN, DF, NC, and XS wrote the original draft. KR, SD, JBo, KD, SJFK, LD, PS, AH, AP, BD, and CS participated in manuscript writing and editing. BS, LvS, WN, DF, SD, DS, JG, AT, and XS made graphs to visualize the data.

Competing interests: BS, LvS, WN, KR, WVB, DF, HE, DDV, CL, SDC, SJFK, JR-P, LD, BD, CS, JN, NC, and XS are named as inventors on patent application Coronavirus Binders (WO 2021/156490 A2), published on August 12 2021. NC and XS are scientific founders of and consultants for ExeVir Bio, and are in receipt of ExeVir Bio share options. DT is employed by ExeVir Bio and is in receipt of ExeVir Bio share options. MG, AH, AP, KB, and AT are in receipt of UCB shares and share options.

Data and materials availability: All data associated with this study are in the paper or supplementary materials. VHH-Fc fusion proteins described in this work will be made available on request to the corresponding authors under a Material Transfer Agreement with VIB.

This work is licensed under a Creative Commons Attribution 4.0 International (CC BY 4.0) license, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. To view a copy of this license, visit https://creativecommons.org/licenses/by/4.0/. This license does not apply to figures/photos/artwork or other content included in the article that is credited to a third party; obtain authorization from the rights holder before using this material.

Source link

Keravita Pro-To Support Good Nails and Hair Keravita Pro-To Support Good Nails and Hair

Leave a Reply

Your email address will not be published. Required fields are marked *

Back to top button